ID: 1142842345_1142842347

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1142842345 1142842347
Species Human (GRCh38) Human (GRCh38)
Location 17:2643344-2643366 17:2643366-2643388
Sequence CCTGGGCTCAAGCTATTCTCCTG GCCTCTGCCCCCCTAATAGCTGG
Strand - +
Off-target summary {0: 98, 1: 5524, 2: 96341, 3: 246040, 4: 247526} {0: 1, 1: 9, 2: 624, 3: 18128, 4: 224695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!