ID: 1142854406_1142854422

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1142854406 1142854422
Species Human (GRCh38) Human (GRCh38)
Location 17:2721917-2721939 17:2721957-2721979
Sequence CCTGGGACCAGAGTGCGGTGGGG CTGGATGCCCAGGAGGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 288} {0: 1, 1: 0, 2: 3, 3: 58, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!