ID: 1142854448_1142854459

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142854448 1142854459
Species Human (GRCh38) Human (GRCh38)
Location 17:2722089-2722111 17:2722137-2722159
Sequence CCTAACAAAGTCACCCTGTTCAC AGGGTCTGTGCACGCTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132} {0: 1, 1: 0, 2: 0, 3: 14, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!