ID: 1142858933_1142858941

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142858933 1142858941
Species Human (GRCh38) Human (GRCh38)
Location 17:2749483-2749505 17:2749504-2749526
Sequence CCCCCACGCTAGCTGCGCCCGGG GGGATCTGCAGCGCCCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60} {0: 1, 1: 0, 2: 1, 3: 13, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!