ID: 1142859103_1142859118

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142859103 1142859118
Species Human (GRCh38) Human (GRCh38)
Location 17:2749962-2749984 17:2750010-2750032
Sequence CCGCGATCCGCTCCGCCCCTCCC CGCCCGCAGCCGCGCAGGCAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!