ID: 1142863368_1142863373

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1142863368 1142863373
Species Human (GRCh38) Human (GRCh38)
Location 17:2776663-2776685 17:2776685-2776707
Sequence CCTGGATCGGCGCGGGCTCCGGC CTGCGCGTGCGCGGCGGCGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 7, 3: 76, 4: 434}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!