ID: 1142866463_1142866472

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1142866463 1142866472
Species Human (GRCh38) Human (GRCh38)
Location 17:2794483-2794505 17:2794516-2794538
Sequence CCAGCAGCCTGAAGCCACCCCAG ACACAATCCTAACTTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 404} {0: 1, 1: 0, 2: 2, 3: 36, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!