ID: 1142866468_1142866472

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1142866468 1142866472
Species Human (GRCh38) Human (GRCh38)
Location 17:2794502-2794524 17:2794516-2794538
Sequence CCAGAGCATGAACCACACAATCC ACACAATCCTAACTTTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 95} {0: 1, 1: 0, 2: 2, 3: 36, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!