ID: 1142866468_1142866473

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142866468 1142866473
Species Human (GRCh38) Human (GRCh38)
Location 17:2794502-2794524 17:2794522-2794544
Sequence CCAGAGCATGAACCACACAATCC TCCTAACTTTCCTGGGGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 95} {0: 1, 1: 0, 2: 3, 3: 17, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!