ID: 1142866469_1142866479

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1142866469 1142866479
Species Human (GRCh38) Human (GRCh38)
Location 17:2794514-2794536 17:2794533-2794555
Sequence CCACACAATCCTAACTTTCCTGG CTGGGGCAGAGGTGAGGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 148} {0: 1, 1: 2, 2: 12, 3: 93, 4: 810}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!