ID: 1142883189_1142883200

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1142883189 1142883200
Species Human (GRCh38) Human (GRCh38)
Location 17:2896743-2896765 17:2896787-2896809
Sequence CCCTTTTTCCTAGCCCTGGTGCA CCTCATCTAATGCACCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 167} {0: 1, 1: 0, 2: 1, 3: 6, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!