ID: 1142885300_1142885307

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142885300 1142885307
Species Human (GRCh38) Human (GRCh38)
Location 17:2908954-2908976 17:2908988-2909010
Sequence CCTTGACCTCCCAAAGTGCTGGG GAGCCACTGCGCCTTGTCGAGGG
Strand - +
Off-target summary {0: 2685, 1: 87313, 2: 209708, 3: 234300, 4: 151543} {0: 1, 1: 0, 2: 16, 3: 250, 4: 1297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!