ID: 1142885302_1142885307

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1142885302 1142885307
Species Human (GRCh38) Human (GRCh38)
Location 17:2908960-2908982 17:2908988-2909010
Sequence CCTCCCAAAGTGCTGGGATTACA GAGCCACTGCGCCTTGTCGAGGG
Strand - +
Off-target summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789} {0: 1, 1: 0, 2: 16, 3: 250, 4: 1297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!