ID: 1142888902_1142888915

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142888902 1142888915
Species Human (GRCh38) Human (GRCh38)
Location 17:2930243-2930265 17:2930274-2930296
Sequence CCTTGTGGCCAATACCATCAGTA GAGCCTGTGGCTGGGGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140} {0: 1, 1: 0, 2: 19, 3: 214, 4: 1438}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!