ID: 1142899332_1142899343

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142899332 1142899343
Species Human (GRCh38) Human (GRCh38)
Location 17:3002630-3002652 17:3002673-3002695
Sequence CCCAGGAGGCCTCCACTGGGGAG GTATAAAGGAGGGACAGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 48, 4: 252} {0: 1, 1: 0, 2: 0, 3: 22, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!