ID: 1142899602_1142899610

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1142899602 1142899610
Species Human (GRCh38) Human (GRCh38)
Location 17:3003961-3003983 17:3003990-3004012
Sequence CCACTTACACGGTCGGCACAGAC AATGCAGGCTGGAGGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27} {0: 1, 1: 0, 2: 9, 3: 75, 4: 695}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!