ID: 1142899602_1142899612

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1142899602 1142899612
Species Human (GRCh38) Human (GRCh38)
Location 17:3003961-3003983 17:3003996-3004018
Sequence CCACTTACACGGTCGGCACAGAC GGCTGGAGGAGGAGGGGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 27} {0: 1, 1: 5, 2: 78, 3: 684, 4: 4818}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!