ID: 1142912253_1142912261

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1142912253 1142912261
Species Human (GRCh38) Human (GRCh38)
Location 17:3104323-3104345 17:3104373-3104395
Sequence CCCCAATGAGATTTGTGGGATAT ATGAAGAAACGGGATGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 153} {0: 1, 1: 0, 2: 1, 3: 15, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!