ID: 1142953688_1142953702

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1142953688 1142953702
Species Human (GRCh38) Human (GRCh38)
Location 17:3505581-3505603 17:3505616-3505638
Sequence CCTGAAGCCTGAGAGTCCCATGG AGAGAGGCCTATACGGGTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 248} {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!