ID: 1142966227_1142966238

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1142966227 1142966238
Species Human (GRCh38) Human (GRCh38)
Location 17:3583518-3583540 17:3583567-3583589
Sequence CCCAGGAGGCACAGCCTCCATCA TTATTAGGGGAGCGCCCGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 365} {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!