ID: 1142967361_1142967370

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1142967361 1142967370
Species Human (GRCh38) Human (GRCh38)
Location 17:3589998-3590020 17:3590049-3590071
Sequence CCACCGAGTCCCTGGCGCTGATG GGAACTTCACGATGCCCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 95} {0: 1, 1: 0, 2: 0, 3: 1, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!