ID: 1142979926_1142979930

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1142979926 1142979930
Species Human (GRCh38) Human (GRCh38)
Location 17:3665790-3665812 17:3665817-3665839
Sequence CCACGGGGACCAGCGCACAGGGT TGGATACGTGTTCGTGAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 187} {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!