ID: 1142980058_1142980068

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1142980058 1142980068
Species Human (GRCh38) Human (GRCh38)
Location 17:3666496-3666518 17:3666543-3666565
Sequence CCAGGAGGAGGAGGAGCAGGTTA GCAGGTGTCCAGAAGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 569} {0: 1, 1: 0, 2: 3, 3: 47, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!