ID: 1142996194_1142996200

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142996194 1142996200
Species Human (GRCh38) Human (GRCh38)
Location 17:3761914-3761936 17:3761945-3761967
Sequence CCAAAACACCGTGGTGGCTCCGG CACTCCCCGGTGCCTCCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43} {0: 1, 1: 0, 2: 2, 3: 20, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!