ID: 1143001741_1143001745

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1143001741 1143001745
Species Human (GRCh38) Human (GRCh38)
Location 17:3799021-3799043 17:3799036-3799058
Sequence CCAGGCCAGGCCAGTCCTGGATT CCTGGATTCTCTCCAGCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 335} {0: 1, 1: 0, 2: 1, 3: 19, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!