ID: 1143002341_1143002346

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1143002341 1143002346
Species Human (GRCh38) Human (GRCh38)
Location 17:3802559-3802581 17:3802577-3802599
Sequence CCATCCTACTTCTGTTGAACCTC ACCTCGTCCCAGGCAGGATCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 211} {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!