ID: 1143014011_1143014019

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1143014011 1143014019
Species Human (GRCh38) Human (GRCh38)
Location 17:3882246-3882268 17:3882287-3882309
Sequence CCTGCATCTACCTGAGCGCGCAG CTTGCTGCTCAGAGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60} {0: 1, 1: 0, 2: 3, 3: 24, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!