ID: 1143014013_1143014019

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1143014013 1143014019
Species Human (GRCh38) Human (GRCh38)
Location 17:3882256-3882278 17:3882287-3882309
Sequence CCTGAGCGCGCAGCCCACGTGGA CTTGCTGCTCAGAGGGAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 67} {0: 1, 1: 0, 2: 3, 3: 24, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!