ID: 1143019186_1143019195

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1143019186 1143019195
Species Human (GRCh38) Human (GRCh38)
Location 17:3907828-3907850 17:3907858-3907880
Sequence CCAGGAGGGCCTCTGGTTCTGTG CAGAAGGAGCTGATGCAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 280} {0: 1, 1: 1, 2: 2, 3: 51, 4: 470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!