ID: 1143037109_1143037117

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1143037109 1143037117
Species Human (GRCh38) Human (GRCh38)
Location 17:4005610-4005632 17:4005629-4005651
Sequence CCCTGCAGACCCTGCACAGAGGG AGGGATCTTCAGAGGCCACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 293} {0: 1, 1: 0, 2: 3, 3: 11, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!