|
Left Crispr |
Right Crispr |
| Crispr ID |
1143055540 |
1143055543 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:4159261-4159283
|
17:4159279-4159301
|
| Sequence |
CCCAAAGTGCCAGGATTGCATGC |
CATGCGTGAGCCACCGCACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 33, 2: 1686, 3: 26890, 4: 266255} |
{0: 36, 1: 8445, 2: 55615, 3: 108937, 4: 146704} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|