ID: 1143057152_1143057157

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1143057152 1143057157
Species Human (GRCh38) Human (GRCh38)
Location 17:4170915-4170937 17:4170943-4170965
Sequence CCACAGACGGAGGGCGGAGGACA GGGCAGAACAGACCGCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94} {0: 1, 1: 0, 2: 0, 3: 14, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!