|
Left Crispr |
Right Crispr |
| Crispr ID |
1143061968 |
1143061976 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:4209382-4209404
|
17:4209414-4209436
|
| Sequence |
CCTCCGCCTCCCGGGTTTACGTG |
CCACAGTCTCCTGAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 145, 2: 5826, 3: 39444, 4: 106136} |
{0: 17, 1: 4781, 2: 109564, 3: 214046, 4: 241592} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|