ID: 1143080833_1143080845

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1143080833 1143080845
Species Human (GRCh38) Human (GRCh38)
Location 17:4380290-4380312 17:4380338-4380360
Sequence CCCGAGTAGCTGGGAATAAAAGG TTTTATTTTTAGTAGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 15, 2: 824, 3: 15092, 4: 250598} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!