ID: 1143090084_1143090093

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1143090084 1143090093
Species Human (GRCh38) Human (GRCh38)
Location 17:4444954-4444976 17:4444978-4445000
Sequence CCTTCCCTGGGCCTGCTGGGCCA CTGCCCTGCCACGGTCGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 69, 4: 521} {0: 1, 1: 0, 2: 1, 3: 11, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!