ID: 1143092236_1143092242

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1143092236 1143092242
Species Human (GRCh38) Human (GRCh38)
Location 17:4455706-4455728 17:4455719-4455741
Sequence CCATCTGGCATCCCCACCCACAG CCACCCACAGACTTCCCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 596} {0: 1, 1: 1, 2: 4, 3: 17, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!