|
Left Crispr |
Right Crispr |
| Crispr ID |
1143099866 |
1143099879 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:4499067-4499089
|
17:4499111-4499133
|
| Sequence |
CCTCGGCGGCGGCGGGCGGCGCG |
GAGCGGCGGCGCCGGCGCCGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 3, 2: 11, 3: 121, 4: 647} |
{0: 1, 1: 1, 2: 17, 3: 140, 4: 855} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|