ID: 1143100587_1143100596

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1143100587 1143100596
Species Human (GRCh38) Human (GRCh38)
Location 17:4502646-4502668 17:4502682-4502704
Sequence CCGCCTGCCTCCCGGGTTGCGTG TGTATCTCGAGCACCTGGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 331} {0: 1, 1: 1, 2: 3, 3: 20, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!