ID: 1143104146_1143104154

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1143104146 1143104154
Species Human (GRCh38) Human (GRCh38)
Location 17:4520016-4520038 17:4520038-4520060
Sequence CCTCCTGACCCTGGACTGCCATG GTCCCAAGGGAAGACACTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 289} {0: 1, 1: 0, 2: 1, 3: 50, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!