ID: 1143108579_1143108589

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1143108579 1143108589
Species Human (GRCh38) Human (GRCh38)
Location 17:4541399-4541421 17:4541427-4541449
Sequence CCGGGAGGCCCCAAGGCCCCCAA ACCCGAACACGACCGCGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 314} {0: 1, 1: 0, 2: 0, 3: 1, 4: 12}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!