ID: 1143121199_1143121207

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1143121199 1143121207
Species Human (GRCh38) Human (GRCh38)
Location 17:4608102-4608124 17:4608124-4608146
Sequence CCCAAAGTCCTCCTGTTCTTCCC CAGGAGGCCCCACAAGTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 352} {0: 1, 1: 0, 2: 2, 3: 14, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!