ID: 1143130382_1143130391

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1143130382 1143130391
Species Human (GRCh38) Human (GRCh38)
Location 17:4673619-4673641 17:4673651-4673673
Sequence CCTGTGAGTCTCCTCCTTGATGA ACATGAGGATGGTCCGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 139} {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!