ID: 1143135543_1143135560

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1143135543 1143135560
Species Human (GRCh38) Human (GRCh38)
Location 17:4710569-4710591 17:4710622-4710644
Sequence CCCAAGACCAGAGCGGGGCCGGG GCGCGCGTGCGCATTGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 140} {0: 1, 1: 0, 2: 1, 3: 6, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!