ID: 1143135548_1143135555

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1143135548 1143135555
Species Human (GRCh38) Human (GRCh38)
Location 17:4710576-4710598 17:4710596-4710618
Sequence CCAGAGCGGGGCCGGGAGGGAGG AGGGGGAAGAGGCGAGAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 587} {0: 1, 1: 0, 2: 1, 3: 54, 4: 716}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!