ID: 1143140616_1143140630

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1143140616 1143140630
Species Human (GRCh38) Human (GRCh38)
Location 17:4739996-4740018 17:4740043-4740065
Sequence CCCGCGCACCCTCCACCGCGAGG GGCTGCAGGTACCGGAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 132} {0: 1, 1: 0, 2: 2, 3: 37, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!