ID: 1143164106_1143164113

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1143164106 1143164113
Species Human (GRCh38) Human (GRCh38)
Location 17:4889438-4889460 17:4889472-4889494
Sequence CCTCTCTCGTCACAGCTACCGGC GCCCAGCCCCGCGGGCCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 91} {0: 1, 1: 0, 2: 0, 3: 18, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!