ID: 1143164724_1143164740

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1143164724 1143164740
Species Human (GRCh38) Human (GRCh38)
Location 17:4892208-4892230 17:4892253-4892275
Sequence CCGGCCAGCCCAGGCAGTCCGTG AACGCCTGGGTGAGGTCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 29, 4: 255} {0: 1, 1: 0, 2: 2, 3: 14, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!