ID: 1143167181_1143167185

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1143167181 1143167185
Species Human (GRCh38) Human (GRCh38)
Location 17:4902620-4902642 17:4902639-4902661
Sequence CCAGTGAGATGAGATTCGTCAGG CAGGGTGACCTTGAGGCTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 66} {0: 1, 1: 0, 2: 4, 3: 30, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!