|
Left Crispr |
Right Crispr |
| Crispr ID |
1143197842 |
1143197850 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:5089761-5089783
|
17:5089796-5089818
|
| Sequence |
CCCTCCTACCTCAGCCTCCCCAG |
CAGACACATGCCACTGCCCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 90, 2: 940, 3: 3161, 4: 6572} |
{0: 1, 1: 10, 2: 120, 3: 1124, 4: 8843} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|