ID: 1143204204_1143204216

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1143204204 1143204216
Species Human (GRCh38) Human (GRCh38)
Location 17:5131533-5131555 17:5131559-5131581
Sequence CCCCATGTCCTTATATCTACAGC CAGTGTCCCCATGGGGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132} {0: 1, 1: 7, 2: 3, 3: 36, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!